Skip to main content
Addgene

pGMC00034 (aka pMC0235)
(Plasmid #210751)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210751 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGMC00009 (SpCas9-2A-GFP-2A-Puro)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non-targeting guide RNA
  • gRNA/shRNA sequence
    GTGTCGTGATGCGTAGACGG
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00034 (aka pMC0235) was a gift from Raj Chari (Addgene plasmid # 210751 ; http://n2t.net/addgene:210751 ; RRID:Addgene_210751)

  • For your References section:

    SERPINB3-MYC axis induces the basal-like/squamous subtype and enhances disease progression in pancreatic cancer. Ohara Y, Tang W, Liu H, Yang S, Dorsey TH, Cawley H, Moreno P, Chari R, Guest MR, Azizian A, Gaedcke J, Ghadimi M, Hanna N, Ambs S, Hussain SP. Cell Rep. 2023 Nov 18;42(12):113434. doi: 10.1016/j.celrep.2023.113434. 10.1016/j.celrep.2023.113434 PubMed 37980563
Related items:
Commonly requested with: