Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGMC00033 (aka pMC0224)
(Plasmid #210750)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210750 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGMC00009 (SpCas9-2A-GFP-2A-Puro)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SERBPINB3 guide RNA
  • gRNA/shRNA sequence
    GAACAGGTCGAACATGAACT
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00033 (aka pMC0224) was a gift from Raj Chari (Addgene plasmid # 210750 ; http://n2t.net/addgene:210750 ; RRID:Addgene_210750)
  • For your References section:

    SERPINB3-MYC axis induces the basal-like/squamous subtype and enhances disease progression in pancreatic cancer. Ohara Y, Tang W, Liu H, Yang S, Dorsey TH, Cawley H, Moreno P, Chari R, Guest MR, Azizian A, Gaedcke J, Ghadimi M, Hanna N, Ambs S, Hussain SP. Cell Rep. 2023 Nov 18;42(12):113434. doi: 10.1016/j.celrep.2023.113434. 10.1016/j.celrep.2023.113434 PubMed 37980563