MCP-MSN
(Plasmid
#210704)
-
PurposeThis plasmid express EF1a promoter driven MCP-MSN transactivation module
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelenti(AMP)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP fused to transactivation domain from Human transcription factor MRTF-A, STAT-1 and NRF2
-
SpeciesH. sapiens (human), Synthetic; bacteriophage MS2
-
Insert Size (bp)870
-
MutationN55K in MCP
-
GenBank IDNM_001282660.2 NM_001384880.1
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggtggaagcggaggaggagga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Stbl3 is also a suitable growth strain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCP-MSN was a gift from Isaac Hilton (Addgene plasmid # 210704 ; http://n2t.net/addgene:210704 ; RRID:Addgene_210704) -
For your References section:
Compact engineered human mechanosensitive transactivation modules enable potent and versatile synthetic transcriptional control. Mahata B, Cabrera A, Brenner DA, Guerra-Resendez RS, Li J, Goell J, Wang K, Guo Y, Escobar M, Parthasarathy AK, Szadowski H, Bedford G, Reed DR, Kim S, Hilton IB. Nat Methods. 2023 Oct 9. doi: 10.1038/s41592-023-02036-1. 10.1038/s41592-023-02036-1 PubMed 37813990