pTT3-ecdICAM1-ST3-His
(Plasmid
#210666)
-
PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210666 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTT3
- Backbone size w/o insert (bp) 5957
- Total vector size (bp) 7475
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExtracellular domain of human ICAM-1 fused to Spytag003 and Histag
-
Alt nameICAM1
-
Alt nameCD54
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1518
- Promoter CMV
-
Tags
/ Fusion Proteins
- Spytag003 (C terminal on insert)
- Histag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGGATACTTCCCAGCCC
- 3′ sequencing primer ATGGTGATGGTGATGATGTTTATACCTCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.15.545075v2 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTT3-ecdICAM1-ST3-His was a gift from Omer Dushek (Addgene plasmid # 210666 ; http://n2t.net/addgene:210666 ; RRID:Addgene_210666) -
For your References section:
Using CombiCells, a platform for titration and combinatorial display of cell surface ligands, to study T-cell antigen sensitivity modulation by accessory receptors. Patel A, Andre V, Eguiguren SB, Barton MI, Burton J, Denham EM, Pettmann J, Morch AM, Kutuzov MA, Siller-Farfan JA, Dustin ML, van der Merwe PA, Dushek O. EMBO J. 2024 Jan;43(1):132-150. doi: 10.1038/s44318-023-00012-1. Epub 2023 Dec 18. 10.1038/s44318-023-00012-1 PubMed 38177315