Tet-pLKO-puro-shTAL1
(Plasmid
#210640)
-
PurposeKnockdown of TAL1 endogenous (3'UTR)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTet-pLKO-puro
-
Backbone manufacturerDmitri Wiederschain, Addgene plasmid #21915
- Backbone size w/o insert (bp) 10633
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAL1 3' UTR gRNA
-
gRNA/shRNA sequenceACCGGCATAACCACTGAAGGGAATCTCGAGATTCCCTTCAGTGGTTATGTTTTTAATTC
-
SpeciesH. sapiens (human)
-
Entrez GeneTAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoR1 (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-puro-shTAL1 was a gift from Maayan Salton (Addgene plasmid # 210640 ; http://n2t.net/addgene:210640 ; RRID:Addgene_210640) -
For your References section:
Isoforms of the TAL1 transcription factor have different roles in hematopoiesis and cell growth. Sharma A, Mistriel-Zerbib S, Najar RA, Engal E, Bentata M, Taqatqa N, Dahan S, Cohen K, Jaffe-Herman S, Geminder O, Baker M, Nevo Y, Plaschkes I, Kay G, Drier Y, Berger M, Salton M. PLoS Biol. 2023 Jun 28;21(6):e3002175. doi: 10.1371/journal.pbio.3002175. 10.1371/journal.pbio.3002175 PubMed 37379322