Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSPgRNA_Ex3_1
(Plasmid #210625)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210625 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSPgRNA
  • Backbone manufacturer
    Charles Gersbach, Addgene plasmid #47108
  • Backbone size w/o insert (bp) 3223
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAL1 Exon 3 gRNA
  • gRNA/shRNA sequence
    GCGGCCCTTTAAGTCTCTCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    TAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

An 8 bp deletion before the gRNA sequence and a 4 bp deletion after the gRNA sequence was found.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPgRNA_Ex3_1 was a gift from Maayan Salton (Addgene plasmid # 210625 ; http://n2t.net/addgene:210625 ; RRID:Addgene_210625)
  • For your References section:

    Isoforms of the TAL1 transcription factor have different roles in hematopoiesis and cell growth. Sharma A, Mistriel-Zerbib S, Najar RA, Engal E, Bentata M, Taqatqa N, Dahan S, Cohen K, Jaffe-Herman S, Geminder O, Baker M, Nevo Y, Plaschkes I, Kay G, Drier Y, Berger M, Salton M. PLoS Biol. 2023 Jun 28;21(6):e3002175. doi: 10.1371/journal.pbio.3002175. 10.1371/journal.pbio.3002175 PubMed 37379322