Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ5135: pCAG-BFP-GuideArray
(Plasmid #210606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210606 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2727
  • Total vector size (bp) 5435
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pCAG-BFP-GuideArray
  • Alt name
    five guides targeting four genes: IL18, IL7, IFNg, and IL2
  • Insert Size (bp)
    2708
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gtaaaacgacggccagt
  • 3′ sequencing primer gatgagtttggacaaaccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5135: pCAG-BFP-GuideArray was a gift from Stanley Qi (Addgene plasmid # 210606 ; http://n2t.net/addgene:210606 ; RRID:Addgene_210606)
  • For your References section:

    Sonogenetic control of multiplexed genome regulation and base editing. Liu P, Foiret J, Situ Y, Zhang N, Kare AJ, Wu B, Raie MN, Ferrara KW, Qi LS. Nat Commun. 2023 Oct 18;14(1):6575. doi: 10.1038/s41467-023-42249-8. 10.1038/s41467-023-42249-8 PubMed 37852951