pHR-SIN-BX SpyCatcher003-hCD52
(Plasmid #210565)

• Purpose: Expresses Spycatcher003 on the cell surface using human CD52 hinge
• Depositing Lab: Omer Dushek
• Publication: Patel et al EMBO J. 2024 Jan;43(1):132-150. doi: 10.1038/s44318-023-00012-1. Epub 2023 Dec 18.

Backbone

• Vector backbone: pHR-SIN
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 10528
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Spycatcher003 fused to human CD52 hinge
• Alt name: hCD52-Spycatcher003
• Species: Synthetic
• Insert Size (bp): 528
• Promoter: SFFV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGGAGACAGACACACTCCTGC
• 3′ sequencing primer: ctaACTGAAGCAGAAGAGGTGGATTATGG

Resource Information

• Supplemental Documents:
  • phr-sin-bx_igk_spyc003_hcd52_insilico-txt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.06.15.545075v2 for bioRxiv preprint