pDestTol2pA ins:TDimer mVenus
(Plasmid
#210520)
-
PurposeExpresses a tandem dimer of mVenus in zebrafish pancreatic beta cells using a zebrafish insulin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDestTol2pA
- Total vector size (bp) 7308
-
Vector typeZebrafish expression, Tol2 kit Gateway-compatible
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTandem dimer mVenus
-
Alt nameTDimer
-
SpeciesSynthetic
-
Insert Size (bp)1458
- Promoter Zebrafish insulin promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGTGAGTGTCGAGCGGGATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Zebrafish insulin promoter cloned from ins:CFP-NTR (Addgene plasmid # 66593 ; http://n2t.net/addgene:66593 ; RRID:Addgene_66593)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2pA ins:TDimer mVenus was a gift from Jonathan Rocheleau (Addgene plasmid # 210520 ; http://n2t.net/addgene:210520 ; RRID:Addgene_210520) -
For your References section:
Apollo-NADP(+) reveals in vivo adaptation of NADPH/NADP(+) metabolism in electrically activated pancreatic beta cells. Bui CV, Boswell CW, Ciruna B, Rocheleau JV. Sci Adv. 2023 Oct 6;9(40):eadi8317. doi: 10.1126/sciadv.adi8317. Epub 2023 Oct 4. 10.1126/sciadv.adi8317 PubMed 37792934