Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RCAS(B)-Rheb-Q64L
(Plasmid #21050)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21050 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 11689
  • Vector type
    Bacterial Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ras-homolog enriched in brain
  • Alt name
    Rheb
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    685
  • Mutation
    glutamine 64 to leucine
  • GenBank ID
    AF493921
  • Entrez Gene
    RHEB (a.k.a. RHEB2)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI(A) (not destroyed)
  • 3′ cloning site SfiI(B) (not destroyed)
  • 5′ sequencing primer AGCTCCGCGGGCCACCATGGACTACAAGGATGACGATGACAAGGCGGCCGCGCCGCAGTCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The creation of RCAS(B)-SfiI and the adapter plasmid pBSFI was described in Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5. The SacII/XbaI fragment was cloned into pBSFI and the Sfi fragment was further cloned into RCAS(B)-SfiI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCAS(B)-Rheb-Q64L was a gift from Peter Vogt (Addgene plasmid # 21050 ; http://n2t.net/addgene:21050 ; RRID:Addgene_21050)
  • For your References section:

    Constitutively active Rheb induces oncogenic transformation. Jiang H, Vogt PK. Oncogene. 2008 Sep 25. 27(43):5729-40. 10.1038/onc.2008.180 PubMed 18521078