pKB33 (pUC19-KANMX-tetO7-CYCpr)
(Plasmid #210472)

• Purpose: Plasmid with KanMX-tetO7-CYCpr cassette from the yTHC collection. Used for amplifying cassette with homology to regions of interest for genomic integration.
• Depositing Lab: Christian Landry
• Publication: Evans-Yamamoto et al Mol Biol Evol. 2023 Nov 18:msad246. doi: 10.1093/molbev/msad246.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2790
• Total vector size (bp): 4934
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KanMX-TetO7-CYCpr cassette
• Species: Synthetic
• Insert Size (bp): 2144

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cggccagtgaattcgagctc
• 3′ sequencing primer: gcctgcaggtcgactctaga

Resource Information

• Supplemental Documents:
  • pkb33.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.02.560513 for bioRxiv preprint.

The KanMX-tetO7-CYCpr cassette was amplified from the Yeast Tet-Promoters Hughes (yTHC) collection (https://horizondiscovery.com/en/non-mammalian-research-tools/products/yeast-tet-promoters-hughes-ythc)

Ref:
T. R. Hughes et al., Functional discovery via a compendium of expression profiles. Cell. 102(1), 109-126 (7 July 2000).