pOttc556 - pAAV EF1a iCre
(Plasmid
#210416)
-
PurposeAAV viral vector packaging plasmid that expresses "improved Cre recombinase"
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOTTC293 - pAAV EF1a V5-tagged synuclein WT
-
Backbone manufacturerNIDA GEVVC (Addgene plasmid # 60057)
- Backbone size w/o insert (bp) 5341
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1056
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer BamHI-Forward ATGGTGCCCAAGAAGAAGAGGA
- 3′ sequencing primer WPRE R1 CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNIDA GEVVC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOttc556 - pAAV EF1a iCre was a gift from Brandon Harvey & Christopher Richie (Addgene plasmid # 210416 ; http://n2t.net/addgene:210416 ; RRID:Addgene_210416)