pOPINVHH_sortase_his
(Plasmid
#210406)
-
Purpose(Empty Backbone) For expression of VHH with C-terminal sortase and his tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepADL-23c
-
Backbone manufacturerAntibody Design Labs
- Backbone size (bp) 3960
-
Modifications to backboneInsertion of LacZalpha and addition of C-terminal sortase tag sequence
-
Vector typeBacterial Expression
- Promoter lac
-
Tag
/ Fusion Protein
- sortase-his6 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcttccggctcgtatgttg
- 3′ sequencing primer gtcgtctttccagacgttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINVHH_sortase_his was a gift from Ray Owens (Addgene plasmid # 210406 ; http://n2t.net/addgene:210406 ; RRID:Addgene_210406) -
For your References section:
From Llama to Nanobody: A Streamlined Workflow for the Generation of Functionalised VHHs. Eyssen LE, Ramadurai S, Abdelkarim S, Buckle I, Cornish K, Lin H, Jones AK, Stephens GJ, Owens RJ. Bio Protoc. 2024 Mar 20;14(6):e4962. doi: 10.21769/BioProtoc.4962. eCollection 2024 Mar 20. 10.21769/BioProtoc.4962 PubMed 38841291