pOPINVHH_his
(Plasmid #210405)

• Purpose: (Empty Backbone) For expression of VHH with C-terminal his tag
• Depositing Lab: Ray Owens
• Publication: Eyssen et al Bio-protocol 14(6): e4962.

Backbone

• Vector backbone: pADL-23c
• Backbone manufacturer: Antibody Design Labs
• Backbone size (bp): 3960
• Modifications to backbone: Insertion of LacZalpha and addition of C-terminal his tag
• Vector type: Bacterial Expression
• Promoter: lac
• Tag / Fusion Protein:
  • his6 (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gcttccggctcgtatgttg
• 3′ sequencing primer: gtcgtctttccagacgttag

Resource Information

• Supplemental Documents:
  • pOPINVHH_his.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry