pOPINVHH_his_flag
(Plasmid
#210404)
-
Purpose(Empty Backbone) For expression of VHH with C-terminal his and Flag tags
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepADL-23c
-
Backbone manufacturer3960
-
Modifications to backboneInsertion of lacZalpha and addition of C-terminal Flag-his tag
-
Vector typeBacterial Expression
- Promoter lac
-
Tag
/ Fusion Protein
- his6-flag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcttccggctcgtatgttg
- 3′ sequencing primer gtcgtctttccagacgttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINVHH_his_flag was a gift from Ray Owens (Addgene plasmid # 210404 ; http://n2t.net/addgene:210404 ; RRID:Addgene_210404) -
For your References section:
From Llama to Nanobody: A Streamlined Workflow for the Generation of Functionalised VHHs. Eyssen LEA, Ramadurai S, Abdelkarim S, Buckle I, Cornish K, Lin H, Jones AK, Stephens GJ, Owens RJ.. Bio-protocol 14(6): e4962. 10.21769/BioProtoc.4962