PRS_8-GCaMP8m
(Plasmid
#210400)
-
PurposeAAV-vector for fluorescent calcium measurements in the green spectrum from noradrenergic neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 4093
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP8m
-
SpeciesSynthetic
-
Insert Size (bp)1269
- Promoter PRSx8
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aacgcgtattagcttccgctag
- 3′ sequencing primer aagcaatagcatgatacaaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.01.22.477348 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRS_8-GCaMP8m was a gift from Simon Wiegert (Addgene plasmid # 210400 ; http://n2t.net/addgene:210400 ; RRID:Addgene_210400) -
For your References section:
Targeting Norepinephrine Neurons of the Locus Coeruleus: A Comparison of Model Systems and Strategies. Wissing C, Eschholz LS, Maheu M, Sauter K, Morellini F, Wiegert S, Dieter A. bioRxiv 2022.01.22.477348 10.1101/2022.01.22.477348