pCB-1
(Plasmid #210387)

• Purpose: All-in-one cumate-based inducible CRISPRi plasmid for use in Streptomyces
• Depositing Lab: Gilles van Wezel
• Publication: Bai et al ACS Synth Biol. 2023 Oct 6. doi: 10.1021/acssynbio.3c00464.

Backbone

• Vector backbone: pTHS
• Backbone manufacturer: Chunbo Lou
• Backbone size w/o insert (bp): 6468
• Total vector size (bp): 13194
• Vector type: CRISPR ; Integrative vector for use in Streptomyces

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: dCas9
• Alt name: Codon optimized SpdCas9
• Insert Size (bp): 4107
• Mutation: The BsaI sites were removed via synonymous mutations
• Promoter: SP30

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tctaagtaaggagtgtccat

Gene/Insert 2

• Gene/Insert name: CymR
• Alt name: CymR repressor
• Species: Pseudomonas putida
• Insert Size (bp): 616
• Promoter: SP11

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cctaacgaggagatcggttc

Gene/Insert 3

• Gene/Insert name: sgRNA cassette
• Species: Synthetic
• Insert Size (bp): 1379
• Mutation: BsaI-flanked RFP cassette inserted in place of spacer
• Promoter: SP30

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caagcggtgatagactaatc

Resource Information

• Supplemental Documents:
  • pCB-1.gb
• A portion of this plasmid was derived from a plasmid made by: We received the backbone as a gift from Prof. Chunbo Lou (Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry