Skip to main content
Addgene

pTSAR3.4t
(Plasmid #210256)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210256 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUdO1a
  • Backbone manufacturer
    Host-Microbe Interactions lab
  • Total vector size (bp) 3914
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Species
    Discosoma sp.
  • Insert Size (bp)
    717
  • Promoter rpsM

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer CTGAATTCAACATTCCAGTGAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    superfolder GFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    750
  • Promoter ipaH7.8p
  • Tag / Fusion Protein
    • ssra (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAATTCCATAGAAAACCTCC
  • 3′ sequencing primer ACTGGCCGTCGTTTTACA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSAR3.4t was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 210256 ; http://n2t.net/addgene:210256 ; RRID:Addgene_210256)
  • For your References section:

    pUdOs: Concise Plasmids for Bacterial and Mammalian Cells. Manigat FO, Connell LB, Stewart BN, LePabic AR, Tessier CJG, Emlaw JR, Calvert ND, Rossl A, Shuhendler AJ, daCosta CJB, Campbell-Valois FX. ACS Synth Biol. 2024 Jan 18. doi: 10.1021/acssynbio.3c00408. 10.1021/acssynbio.3c00408 PubMed 38235654