sgRNA_expression_vector
(Plasmid #210212)

• Purpose: (Empty Backbone) An empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.
• Depositing Lab: Albert Jeltsch
• Publication: Rajaram et al Methods Mol Biol, in press.

Backbone

• Vector backbone: pMulti-sgRNA-LacZ-DsRed (Addgene Plasmid #99914)
• Backbone manufacturer: Yujie Sun
• Backbone size (bp): 4643
• Modifications to backbone: Multiple sgRNA assembly region under Lac promoter in the Addgene Plasmid #99914 was replaced by the region U6 promoter to gRNA scaffold from AIO-mCherry plasmid ( Addgene #74120).
• Vector type: Mammalian Expression, Bacterial Expression
• Promoter: U6
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGGTTTGTCCAAACTCATC
• 3′ sequencing primer: GTGGACTCTTGTTCCAAACTGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry