Skip to main content
Addgene

sgRNA_expression_vector
(Plasmid #210212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210212 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMulti-sgRNA-LacZ-DsRed (Addgene Plasmid #99914)
  • Backbone manufacturer
    Yujie Sun
  • Backbone size (bp) 4643
  • Modifications to backbone
    Multiple sgRNA assembly region under Lac promoter in the Addgene Plasmid #99914 was replaced by the region U6 promoter to gRNA scaffold from AIO-mCherry plasmid ( Addgene #74120).
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Promoter U6
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGGTTTGTCCAAACTCATC
  • 3′ sequencing primer GTGGACTCTTGTTCCAAACTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA_expression_vector was a gift from Albert Jeltsch (Addgene plasmid # 210212 ; http://n2t.net/addgene:210212 ; RRID:Addgene_210212)
  • For your References section:

    Protocol for Allele-Specific Epigenome Editing Using CRISPR/dCas9. Rajaram N, Bashtrykov P, Jeltsch A. Methods Mol Biol. 2024;2842:179-192. doi: 10.1007/978-1-0716-4051-7_9. 10.1007/978-1-0716-4051-7_9 PubMed 39012596