Skip to main content
Addgene

SpyTag003(V114T, V116T)-Talin rod-mCherry
(Plasmid #210027)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210027 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3964
  • Total vector size (bp) 11053
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyTag003(V114T,V116T)-Talin1 rod domain(434-2541)-mCherry
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    7089
  • Mutation
    SpyTag003 V114T and V116T mutations to modify SpyCatcher003 association rate. These mutations do not block isopeptide bond formation.
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acgcaaatgggcggtagg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SpyTag003(V114T, V116T)-Talin rod-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 210027 ; http://n2t.net/addgene:210027 ; RRID:Addgene_210027)

  • For your References section:

    Visible Light-Induced Specific Protein Reaction Delineates Early Stages of Cell Adhesion. Rahikainen R, Vester SK, Turkki P, Janosko CP, Deiters A, Hytonen VP, Howarth M. J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31. 10.1021/jacs.3c07827 PubMed 38104267
Related items: