EGFP-Talin head-SpyCatcher003(K31TAG)
(Plasmid
#210023)
-
PurposeExpression of EGFP-Talin head(1-433)-SpyCatcher003(K31TAG) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneModified pcDNA3 (1xU6-PylT, 1xH1-PylT)
-
Backbone manufacturerDescribed in PMID: 33069552
- Backbone size w/o insert (bp) 5959
- Total vector size (bp) 8383
-
Modifications to backboneOne copy of Desulfitobacterium hafniense pyrrolysyl-tRNACUA (PylT) with G8U under the control of a U6 promoter (1× U6-PylT) and one copy of Methanosarcina barkeri PylT with U25C under the control of a H1 promoter (1× H1-PylT)
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-Talin head (1-433)-SpyCatcher003(K31TAG)
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)2427
-
MutationSpyCatcher003 with K31TAG (Amber stop codon) mutation to allow incorporation of unnatural amino acids.
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer atttaggtgacactatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Talin head-SpyCatcher003(K31TAG) was a gift from Vesa Hytönen (Addgene plasmid # 210023 ; http://n2t.net/addgene:210023 ; RRID:Addgene_210023) -
For your References section:
Visible Light-Induced Specific Protein Reaction Delineates Early Stages of Cell Adhesion. Rahikainen R, Vester SK, Turkki P, Janosko CP, Deiters A, Hytonen VP, Howarth M. J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31. 10.1021/jacs.3c07827 PubMed 38104267