Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP-Talin head-SpyCatcher003(K31TAG)
(Plasmid #210023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210023 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Modified pcDNA3 (1xU6-PylT, 1xH1-PylT)
  • Backbone manufacturer
    Described in PMID: 33069552
  • Backbone size w/o insert (bp) 5959
  • Total vector size (bp) 8383
  • Modifications to backbone
    One copy of Desulfitobacterium hafniense pyrrolysyl-tRNACUA (PylT) with G8U under the control of a U6 promoter (1× U6-PylT) and one copy of Methanosarcina barkeri PylT with U25C under the control of a H1 promoter (1× H1-PylT)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-Talin head (1-433)-SpyCatcher003(K31TAG)
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    2427
  • Mutation
    SpyCatcher003 with K31TAG (Amber stop codon) mutation to allow incorporation of unnatural amino acids.
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer atttaggtgacactatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Talin head-SpyCatcher003(K31TAG) was a gift from Vesa Hytönen (Addgene plasmid # 210023 ; http://n2t.net/addgene:210023 ; RRID:Addgene_210023)
  • For your References section:

    Visible Light-Induced Specific Protein Reaction Delineates Early Stages of Cell Adhesion. Rahikainen R, Vester SK, Turkki P, Janosko CP, Deiters A, Hytonen VP, Howarth M. J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31. 10.1021/jacs.3c07827 PubMed 38104267