pLP202_pCCL_EFSp_mScarlet_WPRE
(Plasmid
#209889)
-
Purposefluorescente reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCCL
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet
-
Insert Size (bp)696
- Promoter EF-1α core promoter
-
Tag
/ Fusion Protein
- mScarlet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tataagtgcagtagtcgccgtg
- 3′ sequencing primer AAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLP202_pCCL_EFSp_mScarlet_WPRE was a gift from Subhojit Roy (Addgene plasmid # 209889)