GOSR2-eGFP
(Plasmid
#209886)
-
PurposeExpresses human GOSR2 (GS27) fused to eGFP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepeGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGOSR2
-
Alt nameGS27
-
Alt nameMembrin
-
Alt nameGolgi SNAP receptor complex member 2
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001012511.2
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GOSR2-eGFP was a gift from Geert van den Bogaart (Addgene plasmid # 209886 ; http://n2t.net/addgene:209886 ; RRID:Addgene_209886)