pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA
(Plasmid
#209788)
-
PurposeExpresses SpRY cas9C by the constitutive CASI promoter and sgRNA targeting the oxidative activation sites of Camk2d by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
- Backbone size w/o insert (bp) 7245
- Total vector size (bp) 7246
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpRY C, Camk2d sgRNA
-
Alt nameSplit-SpRY C-terminal half and Camk2d sgRNA
-
gRNA/shRNA sequenceTCCTGCCTGTGCATCATGGA
-
SpeciesSynthetic
- Promoter CASI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaggaaatcggcaaggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.29.546982v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA was a gift from Yuxuan Guo (Addgene plasmid # 209788 ; http://n2t.net/addgene:209788 ; RRID:Addgene_209788) -
For your References section:
MicroRNA-122-Mediated Liver Detargeting Enhances the Tissue Specificity of Cardiac Genome Editing. Yang L, Liu Z, Chen G, Chen Z, Guo C, Ji X, Cui Q, Sun Y, Hu X, Zheng Y, Li Y, Gao F, Chen L, Zhou P, Pu WT, Guo Y. Circulation. 2024 May 28;149(22):1778-1781. doi: 10.1161/CIRCULATIONAHA.123.065438. Epub 2024 May 28. 10.1161/CIRCULATIONAHA.123.065438 PubMed 38805581
