pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN-miR122 TS
(Plasmid
#209787)
-
PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoter and incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CMV-TadA8e-SpG N aa2-713-InteinN
- Backbone size w/o insert (bp) 7172
- Total vector size (bp) 7131
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTNT4, TadA8e, SpRY N, inteinN, miR122 TS
-
Alt nameTNT4 promoter, TadA8e, Split-SpRY N-terminal half and miR122 target sequences
-
SpeciesSynthetic
-
Insert Size (bp)3839
- Promoter TNT4
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagttaatgattaacccgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.29.546982v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN-miR122 TS was a gift from Yuxuan Guo (Addgene plasmid # 209787 ; http://n2t.net/addgene:209787 ; RRID:Addgene_209787) -
For your References section:
MicroRNA-122-Mediated Liver Detargeting Enhances the Tissue Specificity of Cardiac Genome Editing. Yang L, Liu Z, Chen G, Chen Z, Guo C, Ji X, Cui Q, Sun Y, Hu X, Zheng Y, Li Y, Gao F, Chen L, Zhou P, Pu WT, Guo Y. Circulation. 2024 May 28;149(22):1778-1781. doi: 10.1161/CIRCULATIONAHA.123.065438. Epub 2024 May 28. 10.1161/CIRCULATIONAHA.123.065438 PubMed 38805581