Skip to main content
Addgene

pAAV-cTNT-Cre-miR122 TS
(Plasmid #209784)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209784 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV-cTNT-Cre
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 5331
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR122 ts
  • Alt name
    miR122 TS
  • Species
    Synthetic
  • Insert Size (bp)
    87
  • Promoter cTNT

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aatgctgtgtccctggtgatga
  • 3′ sequencing primer tctattgggaaccaagctgg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-cTNT-Cre-miR122 TS was a gift from Yuxuan Guo (Addgene plasmid # 209784 ; http://n2t.net/addgene:209784 ; RRID:Addgene_209784)

  • For your References section:

    MicroRNA-122-Mediated Liver Detargeting Enhances the Tissue Specificity of Cardiac Genome Editing. Yang L, Liu Z, Chen G, Chen Z, Guo C, Ji X, Cui Q, Sun Y, Hu X, Zheng Y, Li Y, Gao F, Chen L, Zhou P, Pu WT, Guo Y. Circulation. 2024 May 28;149(22):1778-1781. doi: 10.1161/CIRCULATIONAHA.123.065438. Epub 2024 May 28. 10.1161/CIRCULATIONAHA.123.065438 PubMed 38805581
Related items: