Skip to main content
Addgene

pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR)
(Plasmid #209775)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209775 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-Sniper-KRAB, sgSTK3i
  • Alt name
    sgMST2i
  • gRNA/shRNA sequence
    GTTCCCAGAGTTTCCCTCTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    STK3 (a.k.a. KRS1, MST2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR) was a gift from Michael Wehr (Addgene plasmid # 209775 ; http://n2t.net/addgene:209775 ; RRID:Addgene_209775)
  • For your References section:

    Comprehensive split TEV based protein-protein interaction screening reveals TAOK2 as a key modulator of Hippo signalling to limit growth. Ma X, Mandausch FJ, Wu Y, Sahoo VK, Ma W, Leoni G, Hostiuc M, Wintgens JP, Qiu J, Kannaiyan N, Rossner MJ, Wehr MC. Cell Signal. 2024 Jan;113:110917. doi: 10.1016/j.cellsig.2023.110917. Epub 2023 Oct 7. 10.1016/j.cellsig.2023.110917 PubMed 37813295