pAAV-hsyn-dMASS_LF_WPRE
(Plasmid
#209766)
-
PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
- Total vector size (bp) 6481
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedMASS_LF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1967
-
GenBank IDNM_000794
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaagacgatcatcgccctgagc
- 3′ sequencing primer aagcttatcgataatcaacctctgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-dMASS_LF_WPRE was a gift from Andre Berndt (Addgene plasmid # 209766 ; http://n2t.net/addgene:209766 ; RRID:Addgene_209766) -
For your References section:
Optogenetic Microwell Array Screening System: A High-Throughput Engineering Platform for Genetically Encoded Fluorescent Indicators. Rappleye M, Wait SJ, Lee JD, Siebart JC, Torp L, Smith N, Muster J, Matreyek KA, Fowler DM, Berndt A. ACS Sens. 2023 Nov 24;8(11):4233-4244. doi: 10.1021/acssensors.3c01573. Epub 2023 Nov 13. 10.1021/acssensors.3c01573 PubMed 37956352