Skip to main content
Addgene

pCDH-V3-rCD20-BSD
(Plasmid #209754)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209754 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDH-IRES-BSD
  • Backbone size w/o insert (bp) 7456
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS4A1
  • Species
    H. sapiens (human)
  • Mutation
    The CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector.
  • Entrez Gene
    MS4A1 (a.k.a. B1, Bp35, CD20, CVID5, FMC7, LEU-16, S7)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-V3-rCD20-BSD was a gift from Andrei Thomas-Tikhonenko (Addgene plasmid # 209754 ; http://n2t.net/addgene:209754 ; RRID:Addgene_209754)

  • For your References section:

    Alternative splicing of its 5' UTR limits CD20 mRNA translation and enables resistance to CD20-directed immunotherapies. Ang Z, Paruzzo L, Hayer KE, Schmidt C, Torres-Diz M, Xu F, Zankharia U, Zhang Y, Soldan SS, Zheng S, Falkenstein CD, Loftus JP, Yang SY, Asnani M, King Sainos P, Pillai V, Chong ER, Li M, Tasian SK, Barash Y, Lieberman PM, Ruella M, Schuster SJ, Thomas-Tikhonenko A. Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400. 10.1182/blood.2023020400 PubMed 37683180
Related items: