Skip to main content
Addgene

LentiCRISPRv2-sgCD20
(Plasmid #209749)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209749 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 52961)
  • Backbone size w/o insert (bp) 14873
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS4A1
  • gRNA/shRNA sequence
    GGATCATCAGAAGACCCCCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    MS4A1 (a.k.a. B1, Bp35, CD20, CVID5, FMC7, LEU-16, S7)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Can be used to knockout the human CD20 gene, MS4A1. After which, pCDH-V1-rCD20-BSD, pCDH-V2-rCD20-BSD or pCDH-V3-rCD20-BSD can be used to reconstitute CD20 expression with either variants 1, 2 or 3 mRNA isoforms of CD20.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-sgCD20 was a gift from Andrei Thomas-Tikhonenko (Addgene plasmid # 209749 ; http://n2t.net/addgene:209749 ; RRID:Addgene_209749)

  • For your References section:

    Alternative splicing of its 5' UTR limits CD20 mRNA translation and enables resistance to CD20-directed immunotherapies. Ang Z, Paruzzo L, Hayer KE, Schmidt C, Torres-Diz M, Xu F, Zankharia U, Zhang Y, Soldan SS, Zheng S, Falkenstein CD, Loftus JP, Yang SY, Asnani M, King Sainos P, Pillai V, Chong ER, Li M, Tasian SK, Barash Y, Lieberman PM, Ruella M, Schuster SJ, Thomas-Tikhonenko A. Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400. 10.1182/blood.2023020400 PubMed 37683180
Related items:
Commonly requested with: