pAAV-C+F-ArchT-GFP
(Plasmid
#209700)
-
PurposeExpresses ArchT-GFP dependent on the combined activity of CRE- and FLP-recombinases
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArchT-GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer ATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArchT-GFP from Addgene_28307. Another portion of this plasmid was derived from the Addgene plasmid #11925 (pBS302)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-C+F-ArchT-GFP was a gift from Peer Wulff (Addgene plasmid # 209700 ; http://n2t.net/addgene:209700 ; RRID:Addgene_209700) -
For your References section:
Hippocampal cholecystokinin-expressing interneurons regulate temporal coding and contextual learning. Rangel Guerrero DK, Balueva K, Barayeu U, Baracskay P, Gridchyn I, Nardin M, Roth CN, Wulff P, Csicsvari J. Neuron. 2024 Apr 10:S0896-6273(24)00197-1. doi: 10.1016/j.neuron.2024.03.019. 10.1016/j.neuron.2024.03.019 PubMed 38636524