BSD-CryC
(Plasmid #209672)

• Purpose: Expresses CRY2 fused with Split-TurboID-C and mCherry in mammalian cells
• Depositing Lab: Sanjeevi Sivasankar
• Publication: Shafraz et al J Cell Sci. 2023 Oct 1;136(19):jcs261430. doi: 10.1242/jcs.261430. Epub 2023 Oct 11.

Backbone

• Vector backbone: pLX304
• Backbone manufacturer: D. Root
• Backbone size w/o insert (bp): 7700
• Total vector size (bp): 11000
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CRY2
• Alt name: cryptochrome 2
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1800
• GenBank ID: NC_003070.9
• Entrez Gene: CRY2 (a.k.a. AT1G04400, AT-PHH1, ATCRY2, CRYPTOCHROME 2 APOPROTEIN, F19P19.14, F19P19_14, FHA, PHH1, cryptochrome 2)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Split-TurboID-C (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstBI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: gcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • CryC.gb
• A portion of this plasmid was derived from a plasmid made by: CRY2 originally cloned by S. Tucker. TurboID (C) originally cloned by A. TIng.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry