CibN
(Plasmid #209671)

• Purpose: Expresses CIB1 fused with Split-TurboID-N and pmGFP in mammalian cells
• Depositing Lab: Sanjeevi Sivasankar
• Publication: Shafraz et al J Cell Sci. 2023 Oct 1;136(19):jcs261430. doi: 10.1242/jcs.261430. Epub 2023 Oct 11.

Backbone

• Vector backbone: CMV-pmEGFP
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 6100
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CIB1
• Alt name: CIB1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1000
• GenBank ID: BT005313
• Entrez Gene: CIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Split-TurboID-N (C terminal on insert)
  • pmEGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: SacII (unknown if destroyed)
• 5′ sequencing primer: gcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • CibN.gb
• A portion of this plasmid was derived from a plasmid made by: CIB1 originally cloned by C. Tucker. sTurboID (N) originally cloned by A. Ting.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry