ECibN
(Plasmid #209670)

• Purpose: Expresses E-cadherin fused with eGFP, CIB1, and Split-TurboID-N in mammalian cells
• Depositing Lab: Sanjeevi Sivasankar
• Publication: Shafraz et al J Cell Sci. 2023 Oct 1;136(19):jcs261430. doi: 10.1242/jcs.261430. Epub 2023 Oct 11.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 8600
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E-Cadherin
• Alt name: CDH1
• Species: Canis lupus familiaris
• Insert Size (bp): 2700
• GenBank ID: NC_051809
• Entrez Gene: CDH1 (a.k.a. Cadherin-1, Uvomorulin)
• Promoter: CMV
• Tags / Fusion Proteins:
  • eGFP (C terminal on insert)
  • Split-TurboID-N (C terminal on insert)
  • CIB1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: gcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • ECibN.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry