Skip to main content
Addgene

pFlare9A-Clip2E9 WT
(Plasmid #209574)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209574 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFlare9A
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Clip2
  • Alt name
    Clip1; Cyln2; WSCR4; wbscr4; CLIP-115; mKIAA0291; B230327O20
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Entrez Gene
    Clip2 (a.k.a. B230327O20, CLIP-115, Clip1, Cyln2, WSCR4, mKIAA0291, wbscr4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pflare 593 forward: TAGCGCTACCGGACTCAGAT
  • 3′ sequencing primer pflare 1103 reverse: TGGTGCAGATGAACTTCAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFlare9A-Clip2E9 WT was a gift from Sika Zheng (Addgene plasmid # 209574 ; http://n2t.net/addgene:209574 ; RRID:Addgene_209574)

  • For your References section:

    Axonogenesis Is Coordinated by Neuron-Specific Alternative Splicing Programming and Splicing Regulator PTBP2. Zhang M, Ergin V, Lin L, Stork C, Chen L, Zheng S. Neuron. 2019 Feb 20;101(4):690-706.e10. doi: 10.1016/j.neuron.2019.01.022. Epub 2019 Feb 4. 10.1016/j.neuron.2019.01.022 PubMed 30733148
Related items: