sABE v3.22_C
(Plasmid
#209554)
-
PurposepCMV-SV40_NLS-2xFKBP3-TadA-8e(77-167)-SpCas9(D10A)-SV40_NLS-BGHpA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCustom
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xFKBP-TadA-8e(77-167)-SpCas9(D10A)
- Promoter pCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sABE v3.22_C was a gift from Xue Gao (Addgene plasmid # 209554 ; http://n2t.net/addgene:209554 ; RRID:Addgene_209554) -
For your References section:
A split and inducible adenine base editor for precise in vivo base editing. Zeng H, Yuan Q, Peng F, Ma D, Lingineni A, Chee K, Gilberd P, Osikpa EC, Sun Z, Gao X. Nat Commun. 2023 Sep 11;14(1):5573. doi: 10.1038/s41467-023-41331-5. 10.1038/s41467-023-41331-5 PubMed 37696818