pCRISPR-mcBEST
(Plasmid #209416)

• Purpose: Plasmid for multiplexed cytosine base editing in streptomycetes
• Depositing Lab: Tilmann Weber
• Publication: Whitford et al ACS Synth Biol. 2023 Aug 18;12(8):2353-2366. doi: 10.1021/acssynbio.3c00188. Epub 2023 Jul 4.

Backbone

• Vector backbone: pGM1190
• Total vector size (bp): 13213
• Vector type: CRISPR, Synthetic Biology
• Selectable markers: Apramycin

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Growth at 30 C in streptomycetes
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Codon optimized APOBEC1-nCas9-UGI fusion protein
• Alt name: cytosine base editor
• Species: Synthetic
• GenBank ID: none
• Promoter: base editing cassette: PtipA ; sgRNAs: PkasO*

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: caacatgctgtgcggtgttg
• 3′ sequencing primer: gaccctgatccaccagagca

Gene/Insert 2

• Gene/Insert name: csy4 from Pseudomonas aeruginosa PAO1
• Species: Pseudomonas aeruginosa PAO1
• GenBank ID: WP_003162920.1
• Promoter: csy4: PermE*

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: none
• 3′ sequencing primer: none

Resource Information

• Supplemental Documents:
  • pCRISPR-mcBEST_Addgene.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry