LMPd Amt PHGDH
(Plasmid
#209409)
-
PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLMPd Amt
-
Backbone manufacturerChen et al. 2014
-
Vector typeRetroviral
-
Selectable markersAmetrine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhgdh shRNA
-
gRNA/shRNA sequencetgctgttgacagtgagcgcgcactggatgtgtttacagaatagtgaagccacagatgtattctgtaaacacatccagtgcatgcctactgcctcgga
-
SpeciesM. musculus (mouse)
-
Entrez GenePhgdh (a.k.a. 3-PGDH, 3PGDH, 4930479N23, A10, PGAD, PGD, PGDH, SERA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer cgatcctccctttatccagcc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LMPd Amt PHGDH was a gift from Russell Jones (Addgene plasmid # 209409 ; http://n2t.net/addgene:209409 ; RRID:Addgene_209409) -
For your References section:
Metabolic Profiling Using Stable Isotope Tracing Reveals Distinct Patterns of Glucose Utilization by Physiologically Activated CD8(+) T Cells. Ma EH, Verway MJ, Johnson RM, Roy DG, Steadman M, Hayes S, Williams KS, Sheldon RD, Samborska B, Kosinski PA, Kim H, Griss T, Faubert B, Condotta SA, Krawczyk CM, DeBerardinis RJ, Stewart KM, Richer MJ, Chubukov V, Roddy TP, Jones RG. Immunity. 2019 Nov 19;51(5):856-870.e5. doi: 10.1016/j.immuni.2019.09.003. Epub 2019 Oct 10. 10.1016/j.immuni.2019.09.003 PubMed 31747582