Skip to main content
Addgene

LMPd Amt PHGDH
(Plasmid #209409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209409 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LMPd Amt
  • Backbone manufacturer
    Chen et al. 2014
  • Vector type
    Retroviral
  • Selectable markers
    Ametrine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phgdh shRNA
  • gRNA/shRNA sequence
    tgctgttgacagtgagcgcgcactggatgtgtttacagaatagtgaagccacagatgtattctgtaaacacatccagtgcatgcctactgcctcgga
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Phgdh (a.k.a. 3-PGDH, 3PGDH, 4930479N23, A10, PGAD, PGD, PGDH, SERA)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer cgatcctccctttatccagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LMPd Amt PHGDH was a gift from Russell Jones (Addgene plasmid # 209409 ; http://n2t.net/addgene:209409 ; RRID:Addgene_209409)
  • For your References section:

    Metabolic Profiling Using Stable Isotope Tracing Reveals Distinct Patterns of Glucose Utilization by Physiologically Activated CD8(+) T Cells. Ma EH, Verway MJ, Johnson RM, Roy DG, Steadman M, Hayes S, Williams KS, Sheldon RD, Samborska B, Kosinski PA, Kim H, Griss T, Faubert B, Condotta SA, Krawczyk CM, DeBerardinis RJ, Stewart KM, Richer MJ, Chubukov V, Roddy TP, Jones RG. Immunity. 2019 Nov 19;51(5):856-870.e5. doi: 10.1016/j.immuni.2019.09.003. Epub 2019 Oct 10. 10.1016/j.immuni.2019.09.003 PubMed 31747582