LMPd Amt LDHA
(Plasmid
#209408)
-
PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLMPd Amt
-
Backbone manufacturerChen et al. 2014
-
Vector typeRetroviral
-
Selectable markersAmetrine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLdhA shRNA
-
gRNA/shRNA sequenceTGCTGTTGACAGTGAGCGAACTCAATTTGGTCCAGCGAAATAGTGAAGCCACAGATGTATTTCGCTGGACCAAATTGAGTCTGCCTACTGCCTCGGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneLdha (a.k.a. Ldh1, Ldhm, l7R2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer cgatcctccctttatccagcc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LMPd Amt LDHA was a gift from Russell Jones (Addgene plasmid # 209408 ; http://n2t.net/addgene:209408 ; RRID:Addgene_209408) -
For your References section:
Carbon source availability drives nutrient utilization in CD8(+) T cells. Kaymak I, Luda KM, Duimstra LR, Ma EH, Longo J, Dahabieh MS, Faubert B, Oswald BM, Watson MJ, Kitchen-Goosen SM, DeCamp LM, Compton SE, Fu Z, DeBerardinis RJ, Williams KS, Sheldon RD, Jones RG. Cell Metab. 2022 Sep 6;34(9):1298-1311.e6. doi: 10.1016/j.cmet.2022.07.012. Epub 2022 Aug 17. 10.1016/j.cmet.2022.07.012 PubMed 35981545