Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-APOBEC1-YTHmut-EGFP
(Plasmid #209323)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209323 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CAG-EGFP
  • Backbone manufacturer
    Gift from Minmin Luo's lab
  • Backbone size w/o insert (bp) 5430
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    APOBEC1--YTHmut-HA
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Insert Size (bp)
    1347
  • Mutation
    YTH domain lacks AA 385-409 comprising the m6A-binding region
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer APOBEC1-YTH-EGFP_seq_F:gttcggcttctggcgtgtga
  • 3′ sequencing primer APOBEC1-YTH-EGFP_seq_R: cgccctcgccctcgccggac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' cloning sites:KpnI_Kozak_APOBEC1_clone_F:caaagaattggatccggtaccgccaccatgagctcagaga3' cloning sites:P2A_GSG_HA_clone_R1:acagggagaagttagtggcgccgctgccggcgtagtcgggcacgtcgtP2A_R2_clone_R2:ttctcttcgacatcccctgcttgtttcaacagggagaagttagtggcgEGFP_P2A_clone_R3:tcctcgcccttgctcaccattggcccgggattctcttcgacatcccctgc

Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-APOBEC1-YTHmut-EGFP was a gift from Magdalena Koziol (Addgene plasmid # 209323 ; http://n2t.net/addgene:209323 ; RRID:Addgene_209323)
  • For your References section:

    Single cell discovery of m6A RNA modifications in the hippocampus. Feng S, Tellaetxe-Abete M, Zhang Y, Peng Y, Zhou H, Larrea E, Xue L, Zhang L, Koziol MJ. bioRxiv 2023.12.06.570314 10.1101/2023.12.06.570314