AAV-EGFP-APOBEC1
(Plasmid
#209321)
-
PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1 expression.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCAG-EGFP
-
Backbone manufacturerGift from Minmin Luo's lab
- Backbone size w/o insert (bp) 5436
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAPOBEC1-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)777
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EGFP-C_seq_F: catggtcctgctggagttcgtg
- 3′ sequencing primer WPRE-seq_R:cagcgtatccacatagcgta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byKate Meyer (Addgene plasmid # 131636)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:HA_APOBEC1_clone_R: ggcgtagtcgggcacgtcgtaggggtactcgagtttcaacccggtggcccagaWPRE-HindIII-SD-HA-clone-R:tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt
Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EGFP-APOBEC1 was a gift from Magdalena Koziol (Addgene plasmid # 209321 ; http://n2t.net/addgene:209321 ; RRID:Addgene_209321) -
For your References section:
Single cell discovery of m6A RNA modifications in the hippocampus. Feng S, Tellaetxe-Abete M, Zhang Y, Peng Y, Zhou H, Larrea E, Xue L, Zhang L, Koziol MJ. bioRxiv 2023.12.06.570314 10.1101/2023.12.06.570314