Skip to main content
Addgene

psiCHECK2-let-7 4x
(Plasmid #20930)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20930 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4x let-7 target sites
  • Insert Size (bp)
    108

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAAGTACATCAAGAGCTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-let-7 4x was a gift from Yukihide Tomari (Addgene plasmid # 20930 ; http://n2t.net/addgene:20930 ; RRID:Addgene_20930)
  • For your References section:

    Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Mar 4. ():. 10.1016/j.molcel.2009.02.010 PubMed 19268617