psiCHECK2-let-7 2x
(Plasmid
#20929)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepsiCHECK-2
- Backbone size w/o insert (bp) 6273
-
Vector typeMammalian Expression, Insect Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2x let-7 target sites
-
Insert Size (bp)54
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAAGTACATCAAGAGCTTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-let-7 2x was a gift from Yukihide Tomari (Addgene plasmid # 20929 ; http://n2t.net/addgene:20929 ; RRID:Addgene_20929) -
For your References section:
Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Mar 4. ():. 10.1016/j.molcel.2009.02.010 PubMed 19268617