pBJ016_MTB_CoChR_KGC_eGFP_ER2
(Plasmid
#209277)
-
PurposeUbiquitously expresses CoChR in zebrafish via tol2 transgenesis or in vitro transcription of mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMTB
- Backbone size w/o insert (bp) 6329
- Total vector size (bp) 8054
-
Vector typeZebrafish expression, in vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoChR_KGC_eGFP_ER2
-
SpeciesSynthetic
-
Insert Size (bp)1725
- Promoter actb2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggtcacatgcttgctg
- 3′ sequencing primer gcaatagcatcacaaatttc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ016_MTB_CoChR_KGC_eGFP_ER2 was a gift from Adam Cohen (Addgene plasmid # 209277 ; http://n2t.net/addgene:209277 ; RRID:Addgene_209277) -
For your References section:
A bioelectrical phase transition patterns the first vertebrate heartbeats. Jia BZ, Qi Y, Wong-Campos JD, Megason SG, Cohen AE. Nature. 2023 Oct;622(7981):149-155. doi: 10.1038/s41586-023-06561-z. Epub 2023 Sep 27. 10.1038/s41586-023-06561-z PubMed 37758945