pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
(Plasmid
#209198)
-
PurposeMutagenesis of Th
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-FLEX-SaCas9-U6-sgRNA
-
Backbone manufacturerLarry Zweifel (Addgene plasmid # 124844)
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTh
-
gRNA/shRNA sequenceGGACGGCGGCAGAGTCTCATC
-
SpeciesM. musculus (mouse)
-
Entrez GeneTh
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2) was a gift from Larry Zweifel (Addgene plasmid # 209198 ; http://n2t.net/addgene:209198 ; RRID:Addgene_209198) -
For your References section:
Periaqueductal gray/dorsal raphe dopamine neurons contribute to sex differences in pain-related behaviors. Yu W, Pati D, Pina MM, Schmidt KT, Boyt KM, Hunker AC, Zweifel LS, McElligott ZA, Kash TL. Neuron. 2021 Apr 21;109(8):1365-1380.e5. doi: 10.1016/j.neuron.2021.03.001. Epub 2021 Mar 18. 10.1016/j.neuron.2021.03.001 PubMed 33740416