pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
(Plasmid
#209197)
-
PurposeMutagenesis of Faah
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-FLEX-SaCas9-U6-sgRNA
-
Backbone manufacturerLarry Zweifel (Addgene plasmid # 124844)
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFaah
-
gRNA/shRNA sequenceCTGCAGGCTAGGCAAACCCCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneFaah (a.k.a. AW412498)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH was a gift from Larry Zweifel (Addgene plasmid # 209197 ; http://n2t.net/addgene:209197 ; RRID:Addgene_209197) -
For your References section:
A genetic variant of fatty acid amide hydrolase (FAAH) exacerbates hormone-mediated orexigenic feeding in mice. Balsevich G, Petrie GN, Heinz DE, Singh A, Aukema RJ, Hunker AC, Vecchiarelli HA, Yau H, Sticht M, Thompson RJ, Lee FS, Zweifel LS, Chelikani PK, Gassen NC, Hill MN. Elife. 2023 Apr 11;12:e81919. doi: 10.7554/eLife.81919. 10.7554/eLife.81919 PubMed 37039453