pENTR4 AvrRpm1
(Plasmid
#209185)
-
PurposepENTR4 plasmid with CDS of Pseudomonas syringae pv maculicola type III effector AvrRpm1 without stop codon for C-terminal epitope tags
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR4
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 2250
- Total vector size (bp) 2909
-
Vector typeGateway-compatible entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAvrRpm1
-
SpeciesPseudomonas syringae pv. maculicola
-
Insert Size (bp)659
-
GenBank IDAAK49539.1
- Promoter none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCGCCATAAACTGCCAGG
- 3′ sequencing primer CGTTGAATATGGCTCATAACACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.09.25.558804v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR4 AvrRpm1 was a gift from Lennart Wirthmueller (Addgene plasmid # 209185 ; http://n2t.net/addgene:209185 ; RRID:Addgene_209185) -
For your References section:
Untargeted proteomics identifies plant substrates of the bacterial-derived ADP-ribosyltransferase AvrRpm1. Simranjit Kaur, Thomas Colby, Domenika Thieme, Carsten Proksch, Susanne Matschi, eIvan Matić, and Lennart Wirthmueller. bioRxiv 2023.09.25.558804 10.1101/2023.09.25.558804