E12-pCLBabe
(Plasmid #20918)

• Depositing Lab: Stephen Tapscott
• Publication: Yang et al Genes Dev. 2009 Mar 15. 23(6):694-707.

Backbone

• Vector backbone: pBabe
• Backbone size w/o insert (bp): 4500
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E12
• Alt name: E2A (E12 isoform)
• Alt name: TCF3
• Species: H. sapiens (human)
• Insert Size (bp): 1971
• Mutation: G155D
• GenBank ID: NM_0032002
• Entrez Gene: TCF3 (a.k.a. AGM8, AGM8A, AGM8B, E2A, E47, ITF1, TCF-3, VDIR, bHLHb21, p75)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GATCCTCCCTTTATCCAGCCCTC
• 3′ sequencing primer: GGACTTTCCACACCCTAACTGACAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene found a sequence discrepancy resulting in the amino acid change G155D, when compared to Genbank NP_003191. This discrepancy was also present in the original stock of this plasmid and the plasmid should function as described in the associated publication.