Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

E12-cTAP
(Plasmid #20916)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBabe
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E12 cTAP
  • Alt name
    E2A (E12 isoform)
  • Alt name
    Tcfe2a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2547
  • Mutation
    TAP tag is fused to the 3' end of the E12 gene. Mutation A218T (please see depositor's comment below)
  • GenBank ID
    NM_0115483
  • Entrez Gene
    Tcf3 (a.k.a. A1, ALF2, E12, E12/E47, E2A, E47, KA1, ME2, Pan1, Pan2, TCF-3, Tcfe2a, VDIR, bHLHb21)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GATCCTCCCTTTATCCAGCCCTC
  • 3′ sequencing primer GGACTTTCCACACCCTAACTGACAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor noted that the E12 cTAP A218T mutation found in Addgene's quality control sequence does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E12-cTAP was a gift from Stephen Tapscott (Addgene plasmid # 20916 ; http://n2t.net/addgene:20916 ; RRID:Addgene_20916)
  • For your References section:

    MyoD and E-protein heterodimers switch rhabdomyosarcoma cells from an arrested myoblast phase to a differentiated state. Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ. Genes Dev. 2009 Mar 15. 23(6):694-707. 10.1101/gad.1765109 PubMed 19299559